Mice All mouse experiments were performed according to protocols approved by the Institutional Animal Care and Use Committees (IACUC) at Korea Advanced Institute of Science and Technology (KAIST) and the Institute for Basic Science (IBS), adhering strictly to ethical guidelines. B6.Cg-Tg(APPswe, PSEN1dE9)85Dbo/Mmjax (APP/PS1) mice and B6.Cg-Tg(APPSwFlLon, PSEN1*M146L*L286V)6799Vas/Mmjax (5×FAD) mice were produced in our laboratory and
Mice
All mouse experiments were performed according to protocols approved by the Institutional Animal Care and Use Committees (IACUC) at Korea Advanced Institute of Science and Technology (KAIST) and the Institute for Basic Science (IBS), adhering strictly to ethical guidelines. B6.Cg-Tg(APPswe, PSEN1dE9)85Dbo/Mmjax (APP/PS1) mice and B6.Cg-Tg(APPSwFlLon, PSEN1*M146L*L286V)6799Vas/Mmjax (5×FAD) mice were produced in our laboratory and maintained by breeding with C57BL/6J mice. Mice were housed under a 12 h–12 h light–dark cycle. Both male and female mice were used unless otherwise specified in the figure legends. All mice were randomly assigned to experiments, which were performed by investigators blinded to experimental conditions. Gender was not considered unless explicitly noted in figure legends.
Human tissue sections
Human formalin-fixed paraffin-embedded (FFPE) sections were provided by the SNUH Brain Bank and use of these sections for this study was reviewed and determined to be exempt from review by the Public Institutional Review Board designated by the Ministry of Health and Welfare, Republic of Korea. All procedures involving human-derived materials were conducted in accordance with relevant regulations.
Cell lines
HEK293T cells (ATCC) were used solely for AAV production. Cells were maintained in our laboratory and were not independently authenticated for this study. HEK293T cells were confirmed to be free of mycoplasma contamination.
Antibodies and reagents
The antibodies used and their dilution factor were as follows: anti-S100β (Abcam, ab52642, Synaptic System, 287-004; Aves Labs, S100B-0020; 1:500), anti-IBA1 (Wako, 019-19741; Novus, NB100-1028; 1:500), anti-mCherry (Invitrogen, M11217; Aves Labs, mCherry-0020; 1:1,000), anti-vGLUT1 (Millipore, AB5905; 1:1,000), anti-PSD95 (Invitrogen, 51-6900; 1:500), anti-vGAT (Synaptic System, 131-004; 1:1,000), anti-gephyrin (Synaptic System, 147-008; 1:500), anti-FOS (Cell Signaling, 2250S; Synaptic System, 226-308; Synaptic System, 226-017; 1:500), anti-MEGF10 (Merck, ABC10; 1:500), anti-ERBB4 (Abcam, ab32375; Cell Signaling, 4795T; 1:500), anti-parvalbumin (Swant, GP72; 1:1,000), anti-beta amyloid (BioLegend, 803001; Cell Signaling, 2454S; 1:1,000), anti-GFAP (Abcam, ab4674; 1:1,000), anti-AXL (R&D systems, AF854; 1:100), anti-somatostatin (BMA Biomedicals, T-4103; 1:500), anti-VIP (Synaptic System, 443-005; 1:500), anti-NeuN (Sigma-Aldrich, ABN91; 1:500), anti-cleaved caspase-3 (Cell Signaling, 9661S; 1:500), anti-TREM2 (R&D systems, AF1729; 1:500), anti-HA (Cell Signaling, 3724S; 1:500) and anti-pS6 (Cell Signaling, 2211S; 1:500).
Secondary antibodies: donkey anti-goat IgG (H&L) Alexa Fluor 405 (Abcam, ab175665), donkey anti-goat IgG (H+L) Alexa Fluor 488 (Jackson Laboratory, 705-545-003), donkey anti-chicken DyLight 405-conjugated AffiniPure, donkey anti-chicken IgY (IgG) (H+L) (Jackson Laboratory, 703-475-155), donkey anti-chicken IgG (H+L) Alexa Fluor 488 (Jackson Laboratory, 703-545-155), donkey anti-chicken IgG (H+L) Alexa Fluor 594 (Jackson Laboratory, 709-585-155), donkey anti-rat IgG (H+L) Alexa Fluor 594 (Invitrogen, A-21209), donkey anti-rat IgG (H&L) Alexa Fluor 647 (Abcam, ab150155), donkey anti-rabbit IgG (H&L) Alexa Fluor 405 (Abcam, ab175649), donkey anti-rabbit IgG (H+L) Alexa Fluor 488 (Invitrogen, A-21206), donkey anti-rabbit IgG (H+L) Alexa Fluor 594 (Invitrogen, A-21207), donkey anti-guinea pig IgG (H+L) Alexa Fluor 488 (Jackson Laboratory, 706-545-148), donkey anti-guinea pig IgG (H+L) Alexa Fluor 594 (Jackson Laboratory, 706-585-148), donkey anti-guinea pig IgG (H+L) Alexa Fluor 647 (Jackson Laboratory, 706-605-148), donkey anti-sheep IgG H&L (Alexa Fluor 488) (Abcam, ab150177), donkey anti-mouse IgG (H+L) Highly Cross-Adsorbed Secondary Antibody, Alexa Fluor 594 (Invitrogen, A-21203). All Alexa-Fluor-488-conjugated secondary antibodies were used at a dilution of 1:1,000, whereas all other secondary antibodies were used at 1:500. The following reagents were used: HistoVT One (Nacalai, 06380-05), CNO (Sigma-Aldrich, C0832-5mg).
Python packages for data analysis
The following packages were used: Python v.3.10.0, numpy v.2.0.2, pandas v.2.2.3, matplotlib v.3.9.2, collections (built-in module in Python), scanpy v.1.10.4, scvi v.1.3.0, gseapy v.1.1.8, semopy v.2.3.11, pyWGCNA v.2.2.1, statsmodels v.0.14.5, scipy v.1.15.2, scikit-learn v.1.6.1 and magic-impute v.3.0.0.
snRNA-seq analysis
snRNA-seq data were analysed using Cell Ranger v.8.0.1. In brief, raw BCL files from Illumina HiSeq were demultiplexed to generate FASTQ files using ‘cellranger mkfastq’. FASTQ files were further processed with ‘cellranger count’, involving mapping to the mouse reference genome (mm10-2020-A), quantifying gene expression through unique molecular identifiers and cell barcodes, cell clustering and differential gene expression analysis. Multiple sequencing runs were combined using cellranger aggr.
Raw count matrices from 10x Genomics were imported into Scanpy v.1.10.4. Genes expressed in at least 3 cells and cells with 200–8,000 detected genes were used for downstream analysis. Cells with mitochondrial gene content over 5% were excluded. Doublets were removed by scanpy.pp.scrublet by default. After filtering, the selected count value was normalized by Pearson normalization, followed by highly-variable-gene identification with scanpy.experimental.pp.normalize_pearson_residuals and scanpy.experimental.pp.highly_variable_genes, respectively, in Scanpy. With Pearson-normalized counts and about 3,000 highly variable genes, we performed SysVI according to the package tutorial (https://docs.scvi-tools.org/en/stable/tutorials/notebooks/scrna/sysVI.html). Integrations with total cell clusters were performed with 100–200 epochs, whereas integrations with a single cell type such as excitatory neuron, astrocyte or microglia were performed with 5–30 epochs to obtain the minimum reconstruction loss between training set and validation set. Clustering and UMAP analysis were performed using scanpy.tl.leiden and scanpy.tl.umap by default. DEGs were obtained by scanpy.tl.rank_genes_groups using the Wilcoxon rank-sum method and then filtered by adjusted P value and log-transformed fold changes of their expressions. WGCNA was performed in Python with pyWGCNA v.2.2.1, as shown in the vignettes (https://github.com/mortazavilab/PyWGCNA/blob/main/tutorials/Quick_Start.ipynb). GSEA was performed with gseapy v.1.1.8 according to the tutorial (https://gseapy.readthedocs.io/en/latest/introduction.html). We used squared-rooted-normalized counts (numpy.sqrt(scanpy.pp.normalize_total(anndata, inplace=False)[‘X’])) for dot plots, UMAP plots and DEG analysis. We used magic-imputed counts55 for visualization of violin plots, as shown in the vignettes (https://magic.readthedocs.io/en/stable/tutorial.html).
Analysed cell numbers
Cell numbers were as follows: Fig. 2a, 23,217 (3-month-old WT mice), 22,718 (2-month-old 5×FAD mice) and 33,623 (3-month-old 5×FAD mice) cells were analysed; Fig. 2b, 9,069 (3-month-old WT mice), 10,231 (2-month-old 5×FAD mice) and 14,044 (3-month-old 5×FAD mice) excitatory neurons were analysed. For each group, hippocampal samples were derived from two mice.
Figure 5a, 6,763 (sgControl) and 12,826 (sgErbb4) excitatory neurons; Fig. 5b, 3,199 (sgControl) and 2,840 (sgErbb4) microglia; Fig. 5c, 729 (sgControl) and 1,436 (sgErbb4) astrocytes; Fig. 5i, 8,570 (HA) and 10,442 (Erbb4) excitatory neurons; Fig. 5j, 1,037 (HA) and 1,450 (Erbb4) microglia; Fig. 5k, 1,857 (HA) and 1,267 (Erbb4) astrocytes. For each comparison, cells were derived from three mice per group.
Stereotaxic injection for adeno-associated virus transduction
All AAVs were produced in the laboratory as described previously7. In brief, we co-transfected pAAV9 capsid plasmid, helper plasmid for virus assembly and target plasmids into HEK293T (Korean Cell Line Bank) cells using a PEI-based (0.3 mg ml−1) transfection method56. HEK293T cells were maintained with FBS-containing (Gibco) Dulbecco’s modified Eagle’s medium (DMEM, Welgene), which was replaced with serum-free medium during transfection (6–12 h). Transfected cells were incubated in a 37 °C, 5% CO2 conditioned cell incubator. Then, 72 h after medium replacement, culture medium was collected and fresh medium was added. Collected medium was stored at 4 °C. After 48 h, the culture medium and HEK293T cells were collected and purified using the polyethylene-glycol-mediated purification method57. Purified AAVs were concentrated using a 100 kDa Amicon ultra centrifugal filter tube (Millipore) to 200 μl.
For sgRNA targeting Erbb4, the TTAGCGATATTCTTAAACTA sequence was cloned into the SaCas9 vector. The sequence GGTCGGGGCGTATGCGTCTA was cloned into the SaCas9 vector. For sgRNA targeting Rptor, the sequence TGCAGGTCGTATATGGACAG58 was cloned into the SaCas9 vector. For control sgRNA, we used a non-targeting sgRNA sequence with no predicted target sites on the mouse genome, based on previously reported screening59. For overexpression of Erbb4, the Erbb4 cDNA sequence was purchased from Sino Biological (MG51064) and cloned into an AAV target vector. For the kinase-dead mutant of Erbb4, Lys751 was mutated to methionine manually. For control shRNA, CATTGCTGGCACGAAGATTGAC and GTAGCAGAGCACCGTTTACATG were used. For shRNA targeting Megf10, TGAATCTTAAAAATGTGAATCC and GTTATTACAGAACCTAAGTGA were used.
Stereotaxic injection for delivering AAVs into the mouse brains was performed as described previously7,37. In brief, mice were anaesthetized with isoflurane (Piramal) using a veterinary vaporizer (Surgivet). Heads were cleaned using 70% ethanol followed by hair removal and incision of the skin. For ExPre and chemogenetic approaches with hSyn promoter, AAVs were injected at CA3 (mediolateral (ML), −2.5 mm; anteroposterior (AP), −2.0 mm from bregma; dorsoventral (DV), −2.2 mm from the brain surface). For InhiPre, chemogenetic approaches with the Gad67 promoter, SaCas9 with sgRNAs, shRNAs, Erbb4 overexpression and oligomeric Aβ injections were performed at the CA1 (ML, −1.25 mm; AP, −2.0 mm from bregma; DV, −1.5 mm from the brain surface). We injected viruses bilaterally only for behavioural experiments. For oligomeric Aβ injection, mice were euthanized 2 days after injection. For Erbb4 overexpression experiments, mice were euthanized at 2 weeks after injection. For all other AAV-delivered experiments, mice were euthanized at 3 weeks after injection, or as otherwise reported in the figure legend. For chemogenetic approaches, CNO was injected at 0.5 mg per kg concentration for 4 consecutive days before euthanasia. We used same titre for each cohort. The incision was closed with Reflex 7 mm Wound Clips (ROBOZ) after injection.
Immunohistochemistry, FISH, antigen retrieval and image analysis
Mice were anaesthetized with avertin (20 μl g−1) by intraperitoneal injection and perfused with 1× PBS (Welgene) followed by 4% PFA. Brains were post-fixed in 4% PFA at 4 °C overnight and transferred to 30% sucrose in 1× PBS for 48 h. Brains were embedded in OCT compound (Leica), sectioned into 30 μm coronal slices on cryo-stat microtomes (Leica). The sections were permeabilized by blocking buffer (4% BSA, 0.3% Triton X-100 in 1× PBS) for 1 h at room temperature followed by incubation with appropriate primary antibodies for 24 h at 4 °C. The sections were washed with PBST (0.1% Tween-20 in 1× PBS) and stained with the appropriate secondary antibodies conjugated with Alexa Fluor (Invitrogen, Abcam, Jackson ImmunoResearch) in PBST for 2 h at room temperature. The sections were washed and mounted onto slide glasses. TrueBlack (Biotium) diluted to 1/20 in 70% ethanol was applied to the sections for 2 min at room temperature to remove lipofuscin autofluorescence. The sections were washed with distilled water, and Vectashield with or without DAPI (Vector Lab) was used as the mounting medium. The samples were stored at 4 °C before imaging on a confocal laser-scanning microscope.
For immunohistochemistry analysis of ERBB4, we applied antigen retrieval before conventional immunohistochemistry. In brief, slices were placed in an Eppendorf tube filled with 500 μl 1× HistoVT One solution, and incubated at 70 °C for 20 min. After incubation, the slices were moved to a 24-well plate where conventional immunohistochemistry was performed.
For FISH, tissue sections were cut at a thickness of 10 μm and mounted onto SuperFrost Plus glass slides (Thermo Fisher Scientific). The sections were fixed in 4 °C PFA for 15 min, followed by dehydration through a graded ethanol series (50%, 70%, 100% and 100% ethanol; 5 min each) at room temperature. Human FFPE sections were deparaffinized before proceeding according to the same RNAscope workflow. After air-drying, FISH was performed using the RNAscope Multiplex Fluorescent Assay kits (Advanced Cell Diagnostics) according to the manufacturer’s instructions, with minor modifications. The slides were subjected to protease treatment for 30 min, followed by hybridization with target-specific RNAscope probes. All hybridization, amplification and wash steps were carried out manually at room temperature or at the temperatures specified by the manufacturer. Signal detection was achieved using Opal TSA fluorophores (Akoya Biosciences) diluted 1:1,000, depending on the probe and channel requirements. Nuclear counterstaining was performed using DAPI.
All confocal images from the brain sections were acquired using Zeiss LSM880 (×10 lens, ×20 lens or ×40 oil-immersion optical lens) for quantification as described below. Data indicate mice otherwise reported in figure legend.
To quantify Erbb4 mRNA levels in pyramidal neurons in mouse tissues, confocal single-plane images of Gad1 and Erbb4 within the pyramidal layer were isolated. Colocalization between Gad1 and Erbb4 was quantified using the DiAna plugin. To exclude Erbb4 mRNA originating from Gad1+ inhibitory neurons, the colocalized areas were subtracted from the total Erbb4+ areas.
To quantify ERBB4 mRNA levels in excitatory neurons in human tissue, confocal single-plane images of ERBB4, SLC17A7 and DAPI signals were analysed. SLC17A7+ excitatory neurons were identified by the presence of SLC17A7 puncta in DAPI+ nuclei. ERBB4 puncta colocalized with SLC17A7+DAPI+ signal were then measured using the DiAna60 plugin.
To quantify synapse phagocytosis by glial cells, confocal single-plane images of GFP intensity subtracted from mCherry intensity (mCherry intensity − GFP intensity; mCherry alone) along with glial cells (S100β and IBA1) were separately isolated, and the areas of colocalization (mCherry alone+, glial cell+) were measured using the DiAna60 plugin. To compensate for differences in the injected viruses, the colocalization areas were normalized to GFP areas.
To quantify synapse numbers, confocal single-plane images of excitatory synapses (vGLUT1 and PSD95) and inhibitory synapses (vGAT and gephyrin) were separately isolated, and the areas of themselves and their colocalization were measured using the Analyze Particle function in ImageJ and DiAna plugin, respectively.
To quantify the areas of GFAP, S100β, IBA1 and Ab, confocal single-plane images of these markers were isolated, and their areas were measured by Analyze Particle function.
To quantify the areas of pS6 in the pyramidal neurons and PV+ neurons, confocal single-plane images of pS6, PV and NeuN were isolated, and their colocalization (pS6+PV+NeuN+ or pS6+PV−NeuN+) was measured using the DiAna plugin.
To quantify the areas of DAM population (AXL+/TREM2+), confocal single-plane images of AXL, TREM2 and IBA1 were isolated, and their colocalization (AXL+IBA1+ or TREM2+IBA1+) was measured using the DiAna plugin.
To quantify MEGF10 in shRNA-applied samples, confocal single-plane images of MEGF10 and TagBFP were separately isolated, and the colocalization areas were measured using the DiAna plugin. To compensate for differences in the labelled astrocytes, the colocalization areas were normalized to TagBFP areas.
To quantify cleaved caspase-3+, FOS+ or ERBB4+ neurons, confocal z-stacked images of cleaved caspase-3, FOS or ERBB4 with neuronal markers (PV, SST or VIP with NeuN) were merged, and the numbers were manually counted.
Slice electrophysiology
Mice were anaesthetized with isoflurane and decapitated. The brains were quickly removed and transferred into ice-cold artificial cerebrospinal fluid (ACSF) continuously bubbled with 95% O2 and 5% CO2. The ACSF consisted of 125 mM NaCl, 2.5 mM KCl, 1.25 mM NaH2PO4, 25 mM NaHCO3, 1 mM MgCl2, 2 mM CaCl2 and 15 mM glucose. Coronal slices were cut in ice-chilled ACSF using a vibratome (VT1200S, Leica). After slicing, the sections were allowed to recover in ACSF at 34 °C for 20 min, followed by incubation at room temperature for at least 40 min. For recordings, slices were placed into a submerged recording chamber and continuously perfused with oxygenated ACSF at a flow rate of 2–3 ml min−1. The chamber temperature was maintained at 30–31 °C, and recordings were performed within 4–5 h after the recovery period. Neurons were visualized using infrared differential interference contrast microscopy with an upright microscope (BX51WI, Olympus). Whole-cell voltage-clamp recordings were obtained with borosilicate glass pipettes (2.5–3.5 MΩ) filled with a Cs+-based low-Cl− internal solution containing 135 mM CsMeSO3, 10 mM HEPES, 1 mM EGTA, 3.3 mM QX-314, 0.1 mM CaCl2, 4 mM Mg-ATP, 0.3 mM Na3-GTP, 8 mM Na2-phosphocreatine (290–300 mOsm, pH 7.3 adjusted with CsOH). Recordings were included in the analysis only when the access resistance was between 10–20 MΩ and remained stable, with less than 20% change throughout the experiment. Whole-cell patch-clamp recordings were acquired using the Multiclamp 700B (Molecular Devices) system and signals were filtered at 2 kHz and digitized at 10 kHz (NI PCIe-6259, National Instruments). Data were monitored and acquired by WinWCP (Strathclyde Software), further analysed using Clampfit v.10.7 (Molecular Devices) and OriginPro 2017 (OriginLab). To measure the mEPSCs and mIPSCs, Nav channel blocker (TTX, 500 nM, Alomone Labs, T-550) and NMDA receptor antagonist (D-AP5, 25 μM, Tocris, 0106) were added to ACSF and applied throughout the recording session. Both mEPSCs and mIPSCs were recorded in the same cell. mEPSCs were obtained at −70 mV (reversal potential of chloride), and mIPSCs were subsequently obtained at 0 mV (reversal potential of ionotropic glutamate receptors). mEPSCs and mIPSCs were recorded for 3 min each. mEPSCs were analysed over the entire 3 min recording period, whereas mIPSCs were analysed during a 60 s segment from 60 s after the start of recording.
For intrinsic excitability recordings, coronal slices containing the dorsal hippocampal CA1 (300 µm) were cut in ice-cold oxygenated sucrose-based cutting solution containing 75 mM sucrose, 76 mM NaCl, 2.5 mM KCl, 25 mM NaHCO3, 25 mM glucose, 1.25 mM NaH2PO4, 7 mM MgSO4, 0.5 mM CaCl2 with pH 7.3, equilibrated with 95% O2 and 5% CO2, using a vibratome (Leica, VT1200S), and then recovered in the same solution for 30 min at 32 °C. Slices were then transferred to an incubation chamber filled with oxygenated ACSF containing 124 mM NaCl, 2.5 mM KCl, 1.3 mM MgCl2, 2.5 mM CaCl2, 1.0 mM NaH2PO4, 26.2 mM NaHCO3 and 20 mM glucose with pH 7.4 at room temperature and slices were kept for less than 6 h before recordings.
For patch-clamp recordings, slices were transferred to a recording chamber perfused with oxygenated ACSF at 30–32 °C controlled by a peristaltic pump. Patch microelectrodes were pulled from borosilicate glass (Harvard Apparatus, 30-0065) using a micropipette puller (Narishige, PC-10). Patch microelectrodes had a resistance of 5.0–7.0 MΩ. Signals were recorded using a patch-clamp amplifier (Multiclamp 700B, Molecular Devices) and digitized with Digidata 1550 digitizer (Molecular Devices) using Clampex software (Molecular Devices). Signals were amplified, filtered at 2 kHz and sampled at 10 kHz.
In current-clamp recordings, the membrane potential was held at −70 mV with intracellular solution: 135 mM K-gluconate, 7 mM NaCl, 10 mM HEPES, 0.5 mM EGTA, 2 mM Mg-ATP, 0.3 mM Na2-GTP and 10 mM Na-phosphocreatine with pH 7.3 and 295 mOsm. Current-clamp experiments were recorded 5 min after obtaining whole-cell configuration. To evaluate intrinsic excitability, 500 ms depolarizing currents were injected from −200 to 500 pA with increments of 50 pA, and the mean firing rate was calculated based on the number of evoked action potentials in response to a depolarizing current injection. The input resistance (Rin) was estimated as the slope of the I–V relationship derived by measuring the difference between the baseline and the steady-state.
Behavioural test
Both novel-object recognition test and novel-object location test were performed in a square box (acrylic box, 30 cm × 30 cm × 28 cm, W × D × H, custom-made). One side of the box has a stripe to give information about location. Both tasks are composed of three steps: habituation, training and testing.
For the novel-object location test, mice were habituated to the testing box by freely moving in the open-field arena for 10 min. Then, 24 h after habituation, the mice were placed into the box, which contained two identical objects, for 10 min for training. Then, 24 h after training, the mice were again placed in the box, in which one object was moved to a new location for 10 min.
For the novel-object recognition test, mice were habituated under the same conditions as for the novel-object location test. At the training step, mice were exposed to two identical objects. For the testing step, one of the two objects was replaced with a novel object.
For spontaneous alternation, mice were placed on the centre of a Y-maze (acrylic box, 5 cm × 30 cm × 15 cm, W × D × H for one arm, custom-made) for 8 min.
To quantify performance in the novel-object location test and novel-object recognition test, the time spent interacting with the objects for both the old and novel object and location were measured. Then, the discrimination index was calculated according to the following equation:
$$\frac{\mathrmKeep following us for the latest insights.\,\mathrmKeep following us for the latest insights.\,\mathrmFor more tech updates, stay tuned to our blog.\,\mathrmFor more tech updates, stay tuned to our blog.\,\mathrm{object}\,\mathrm{or}\,\mathrm{object}\,\mathrm{at}\,\mathrm{novel}\,\mathrm{location}\times 100}{\mathrm{Time}\,\mathrm{interacting}\,\mathrm{with}\,\mathrm{old}\,\mathrm{object}\,\mathrm{or}\,\mathrm{object}\,\mathrm{at}\,\mathrm{old}\,\mathrm{location}+\mathrm{Time}\,\mathrm{interacting}\,\mathrm{with}\,\mathrm{novel}\,\mathrm{object}\,\mathrm{or}\,\mathrm{object}\,\mathrm{at}\,\mathrm{novel}\,\mathrm{location}}$$
For quantification of spontaneous alternation, arm entry for all arms was quantified and alternation percentages were calculated by the following equation:
$$\frac{\mathrm{Spontaneous}\,\mathrm{alternation}\times 100}{\mathrm{Totala}\,\mathrm{arm}\,\mathrm{entries}-2},$$
where spontaneous alternation was defined as sequential arm entry for all arms.
For the Barnes maze, we followed the shortened protocol as described previously41. In brief, the maze consisted of a circular white platform (1 m diameter) elevated approximately 1 m above the floor, with 20 evenly spaced holes along the perimeter, one of which led to a dark escape cage. The task was performed in three phases: habituation, training and probe. On the habituation day, the mice were placed at the centre of the maze for 30 s and then gently guided to the target hole to allow familiarization with the escape cage. During the training phase, the mice were placed inside a transparent cylinder at the centre of the maze for 10 s, after which the cylinder was removed. Mice were allowed to explore the maze for up to 2 min per trial to locate the target hole. Training consisted of five trials over 2 days (three trials on day 1 and two trials on day 2), with an inter-trial interval of approximately 20 min. If a mouse failed to enter the escape cage within the allotted time, it was gently guided to the target hole. Primary latency, defined as the time from trial onset to the first nose poke at the target hole, was recorded as a measure of spatial learning. One day after final training session, a probe trial was conducted in which the escape cage was removed, and mice were allowed to explore the maze for 2 min. Time spent in each quadrant was recorded as a measure of spatial memory.
All behavioural tests were performed by researchers blinded to the groups assignments.
Illustrations
All illustrations were generated using a BioRender with a licence (https://www.biorender.com).
Software and statistical analysis
Zen (Zeiss) software acquisition system was used for acquisition of confocal images. For image analysis, ImageJ (NIH) and its plugin DiAna60 were used.
No statistical methods were used to predetermine sample sizes. All statistical analyses were performed using GraphPad Prism 10 with 95% confidence. The Shapiro–Wilk test was first performed for all data to determine normality of the data distribution. If the data passed normality testing, comparisons between two groups were performed using two-tailed unpaired Student’s t-tests. For data that did not follow a normal distribution, the Mann–Whitney U-test was used. For comparisons of markers measured from different mouse brains, unpaired tests were applied, whereas for measurements obtained from the same mouse brain following bilateral injection of different AAVs, paired tests were used. For comparison of more than three groups with normal distribution, one-way ANOVA followed by Tukey’s multiple-comparison test was used. For comparison of more than two groups with two independent variables, two-way ANOVA followed by Tukey’s multiple-comparison test was used. For comparison of cell numbers in the excitatory neuronal cluster (Extended Data Fig. 5a,f), the generalized estimating equation test was performed using statsmodels v.0.14.5 in Python v.3.10. For comparison of excitability (Extended Data Fig. 7v), a linear mixed model was used and corrected using the ‘fdr_bh’ method in statsmodels and scipy v.1.15.2 in Python. For directed mediation analysis, statsmodels and semopy v.2.3.11 were used in Python. Linear regression was used by scikit-learn v.1.6.1 in Python. The statistical test used for each experiment is reported in the results.
Ethics statement
All animal experiments were performed in accordance with protocols approved by the Institutional Animal Care and Use Committees of the Korea Advanced Institute of Science and Technology and the Institute for Basic Science. Human FFPE hippocampal sections were provided by the SNUH Brain Bank. Their use in this study was reviewed and determined to be exempt from protocol review by the Public Institutional Review Board designated by the Ministry of Health and Welfare, Republic of Korea. All procedures involving human-derived materials were conducted in accordance with relevant regulations.
Reporting summary
Further information on research design is available in the Nature Portfolio Reporting Summary linked to this article.
{For more tech updates, stay tuned to our blog.|Keep following us for the latest insights.|Check back often for more exciting news!}

















